Author Archives: Hasan
Verbal 899km by multiple students (last 3 years)
- What did RNA say to DNA? OH OH OH – Abbas Karam
- Why did DNA Pol fail a replication exam? Didn’t proofread – Abbas Karam
- اكسر للبنت ضلع يطلع لها اتنين (replication fork) – أسيل العازمي
- لزقه ريح لا تبرى ولا تستريح (Repressor binding) – وجود حمود
- اذا تليت حزامه تهلهلت عظامه (DNA hydrogen bonds) – زهراء أرتي
- اقلب الجرة على فمها تطلع البنت على أمها، واقلب ال (DNA) على ال (RNA) يطلع البروتين على كودونه – زهراء أرتي
- من بره هالله هالله (Phenotype) ومن داخل يعلم الله (Genotype) – زكيه جلال
- ما لك الا خشمك ولو كان عوي (Mutations) – رشا عبدالله
- ايد وحده ما تصفق وال (DNA) بروحه ما يصير له (Replication) – مروه نور
- تجعيم (اسكات) الجينات (RNAi) – موضي الحسين
- انطر يا حمار لمن يجيك الربيع وانطر يا (mRNA) لمن يجيك ال (Ribosome) – هيا سعود
- كل جدر وله غطاه وكل (DNA motif) وله (Regulatory protein) – نوره عواد
- من شابه أباه فما ظلم (Mendel’s monohybrid experiment) – مريم سليمان
- العرق دساس وال (DNA) دساس – ندى أسامه
- العرق يمد لسابع جد وال (Haplotype) يمد لأكثر – ندى أسامه
- كل ما أشوف خيط ملفوف على بكره اتذكر ال (DNA) شلون يلف على (Histone octamer) – ساره المطوع
- الي بالجدر يطلعه الملاس والي بال (Sample) يطلعه ال (Phenol-chloroform) – يوسف جمال
- غلطة الشاطر بألف وغلطة ال (DNA polymerase) ب (Mutation) – إيمان الرشيدي
- من سبق لبق (Competitive binding) – رقيه محمود
- انفخ يا شريم قال ما من برطم. اطلع يا بروتين قال ما من جين – نوال الشمري
- انفخ يا شريم قال ما من برطم. انسخ يا (Polymerase) قال ما من (Primer) – نوال الشمري
- لو تنشد عني يا صاحبي تلقى فيني من وفا ال (Guanine) لل (Cytosine). مستحيل أبد إني أكون مثل ال (Adenine) بكل ديره له صاحب. تلقاه في ال (DNA) يخاوي ال (Thymine) ولين شاف ال (RNA) صار ال (Uracil) أعز أصحابه – هاجر محمود
Visual 899km by Zainab Dashti
Visual 899km by Amnah Rezig
Verbal 899km by Bibi Alandaleeb
- A journey of a thousand proteins begins with an AUG
- Actions speak loader than words and amino acids speaks loader than their codons
- Every Romeo has his Juliet and Every Purine has its Pyrimidine
- عصفور في اليد ولا عشرة على الشجرة (A gene expressed is better than ten untranscribed)
-
- درهم (proofreading) خير من قنطار (DNA repair)
بيبي العندليب
Summer 2016 verbal stories
-
إن غاب القطو العب يا فار، وإن غاب اللاكتوز العب يا (Lac repressor)
-
مد الرجول على قد اللحاف، ومد البروتين على قد ال (mRNA)
منال صباح
-
لو كنتو نسيتوا ايه الي جرى، هاتوا تقارير ال (DNA) تنقرا
-
يا واخد القرد على ماله، يروح المال ويبقى ال (DNA) على حاله
شروق نبيل
-
زهب الدوا قبل الفلعه، وزهب ال (Initiation complex) قبل ال (Transcription)
-
من جاء من دون عزيمة قعد بدون فراش، ومن جاء بدون (Ribosome) قعد بدون (Translation)
زهراء المؤمن
-
بعض الطلبة عندنا قدوتهم مندل، تخصصهم بالعلوم ومساندهم شريعة
-
الموتيف بال (Operator) صاير مثل مسمار جحا حق (Repressor)
عبدالله الغريب
-
انفخ يا (DNA Polymerase) قال ما من (Template)
نوره البراك
-
When you get married, don’t CUT that ONE ring of your finger
-
Dr. CATGCC should UAA giving us examples of food during his lectures especially during AGGGCCATGGCAGACGCTAAT
Othman Saleh
-
It is really interesting that translation of the genetic code always starts in AUG (August)
Saleh Alfaraj
EHARB Spring 2016
This semester we will have a paper (or two) every week and we will meet on Mondays 12-1 pm in my lab 2kh (103). All are welcome to come. If you have papers you want us to discuss, please send me an email and I will be more than happy to include it in the list.
8/2/2016
The past, present and future of genomic scans for selection. by Jensen et al.
22/2/2016
29/2/2016
Signatures of positive selection in East African Shorthorn Zebu: A genome-wide single nucleotide polymorphism analysis. by Behbahani et al.
7/3/2016
Scans for positive selection reveal candidate genes and local adaptation of Peromyscus leucopus populations to urbanization. by
14/3/2016
A Spatial Framework for Understanding Population Structure and Admixture. by Bradburd et al.
21/3/2016
Genetical Genomics of Behavior: A Novel Chicken Genomic Model for Anxiety Behavior. by Johansson et al.
28/3/2016
The sequence of sequencers: The history of sequencing DNA. by James M. Heather and Benjamin Chain
4/4/2016
Beyond Bar and Line Graphs: Time for a New Data Presentation Paradigm. by Weissgeber
11/4/2016
90 Years Ago: The Beginning of Hybrid Maize. by
18/4/2016
Complex disease and phenotype mapping in the domestic dog. by Hayward et al.
25/4/2016
Uner Tan Syndrome: History, Clinical Evaluations, Genetics, and the Dynamics of Human Quadrupedalism. by Uner Tan
Mutations in the very low-density lipoprotein receptor VLDLR cause cerebellar hypoplasia and quadrupedal locomotion in humans. by Ozcelik et al.
Papers selected by Ali Alhaid
Jamalid Report #1
The A-maize-ing
We discussed during EHRAB (25/11/15) Wang et. al. 2015 about corn domestication. I learned the effects of a single and simple mutation on a phenotype. A SNP in the tga1 gene changes the phenotype from short, small and capsulated of teosinte to tall, big and naked kernels of maize. The paper and the interesting discussion inspired me to make the little sketch below.
Huda Alaskar, B.Sc. Molecular Biology
A friendly list to our best
To earn a degree, beyond your bachelor’s, U.S. graduate schools always state: A student must produce a “significant body of work”.
What does that mean?
Here are our guidelines for what it means to earn a graduate degree under our supervisions. This does not include what KU requires for your course work. This is what we expect you to master, with our help, before you leave us 🙂
We hope this helps each of us to stay on track. Please ask yourself these questions as you are trying to graduate.
- Your training in graduate school is to prepare you to be a free and independent thinker who is capable of producing knowledge rather than only memorizing facts from books and articles. Are you a free and independent thinker?
- Scientific literature comes in many forms nowadays. This includes articles, books, popular science, websites, etc. Do you read relevant scientific literature?
- Knowledge, ideas, and thoughts cannot be memorized. Your “significant body of work” comes primarily from the lab. Did you master taking/organizing your lab notes/computer files/literature and all forms of data?
- The science you do in the lab is not what your PI asks you to do with a specific deadline. Performing experiments requires learning how to coordinate with others plus how to manage your time and the resources. Can you propose/plan/execute new experiments?
- Nothing in the real world of science is like the figures you see in textbooks. The path to “significant body of work” is not a straight line. Have you learned how to trouble shoot and solve technical problems?
- Your scientific value comes from the skills you develop and techniques you master. What techniques have you picked up practically? What other techniques have you learned from only listening to your peers?
- Data Data Data! Your “significant body of work” needs data to come to life. What data have you generated? Is it high quality, reproducible and valid?
- Generating data is relatively an easy task while analyzing the data and producing clear explanation is quite challenging. Do you know how to analyze and present your data and results?
- You do not perform experiments in a dusty and dark dungeon. Your experiments should be in accordance with current thinking and findings of your field. Can you integrate your results into the current thinking/literature of the field?
- Knowledge becomes knowledge by sharing. You cannot become a scientist or produce “a significant body of work” by hiding your findings. You should develop the skills that enable you to share your science and findings. Have you mastered being able to organize your thoughts cohesively to be able to present them professionally to others (both orally = PowerPoint’s, and written= posters, thesis and papers)?
- Communication, communication, communication! You do not have to like an individual to communicate with. Communication in science is not making friends or befriending others. It is your way to the “significant body of work”. Were you respectful, supportive, helpful and able to “get along” and communicate well with ALL of your lab partners, your supervisors and the lovely administration at KU? (That’s a big task!!!)
- Seriousness will seriously get you sick. To produce your “significant body of work”, you need to enjoy and have fun doing it. Your graduate school experience is like running a marathon. It will not end within a semester after earning a good grade. For some, like your professors, the marathon will be a life-long pursuit. Did you learn to have fun/appreciate when things were going well, and to stay flexible/determined/resilient when things didn’t go so well?
- You will not know everything. You will not know everything even in your field. Being smart at this period of your life is not by knowing everything. It is rather by knowing what you don’t know. You should be comfortable to say, “I do not know”. It is okay not to know things and it should be your drive to know more. Have you said, “I do not know” to yourself? Are you comfortable saying, “I do not know but I will look into it” before an audience?
- GREAT 🙂 You did it!!! CONGRATULATIONS.
Now, we have both done our jobs.




